ChemicalConvert[cheminst,targetunit]
converts the quantity in the specified instance cheminst to targetunit.
ChemicalConvert[cheminst]
converts to SI base units.
ChemicalConvert
ChemicalConvert[cheminst,targetunit]
converts the quantity in the specified instance cheminst to targetunit.
ChemicalConvert[cheminst]
converts to SI base units.
Details
- cheminst must be a ChemicalInstance or EntityInstance expression.
- The targetunit can be a canonical unit, a Quantity expression, a QuantityVariable expression or a "PhysicalQuantity" Entity.
- When targetunit is a Quantity, the result will have the same unit as targetunit.
- When targetunit is a QuantityVariable expression or a "PhysicalQuantity" Entity, the result will use the corresponding canonical unit.
- A targetunit specification can also be one of the following unit systems: "SIBase", "SI", "Imperial", "Conventional" or "Metric".
- ChemicalConvert uses standard temperature, 293.15 K (20 °C), and standard pressure, 101325 Pa (1 atm), as the default values for "Temperature" and "Pressure".
Examples
open all close allBasic Examples (4)
Calculate the number of millimoles in 2300 milligrams of sodium:
ChemicalConvert[ChemicalInstance[Entity["Element", "Sodium"], Quantity[2300, "Milligrams"]], "Millimoles"]Calculate the number of molecules in 10 mL of water:
ChemicalConvert[ChemicalInstance[Entity["Chemical", "Water"], Quantity[10, "Milliliters"]], "Molecules"]Calculate the volume in cubic feet of 10 moles of helium:
ChemicalConvert[ChemicalInstance[Entity["Element", "Helium"], Quantity[10, "Moles"]], "Feet"^3]Express the mass of 10 ounces of urea in SI units:
ChemicalConvert[ChemicalInstance[Entity["Chemical", "Urea"], Quantity[10, "Ounces"]], "SIBase"]ChemicalConvert[ChemicalInstance[Entity["Chemical", "Urea"], Quantity[10, "Ounces"]]]Scope (5)
Calculate the equivalent amount of 10 mL of water at a nonstandard temperature and pressure:
ChemicalConvert[ChemicalInstance[Entity["Chemical", "Water"], <|"Volume" -> Quantity[10, "Milliliters"], "Temperature" -> Quantity[450, "Kelvins"], "Pressure" -> Quantity[2, "Bars"]|>] , Entity["PhysicalQuantity", "Amount"]]Calculate the volume of 5 moles of mercury:
ChemicalConvert[ChemicalInstance[Entity["Element", "Mercury"], <|"Amount" -> Quantity[5, "Moles"]|>], Volume]Calculate the mass of a trillion molecules of caffeine:
ChemicalConvert[ChemicalInstance[Entity["Chemical", "Caffeine"], Quantity[1000000000000, "Molecules"]], Quantity[1, "Grams"]]Calculate the mass of 0.6 moles of the drug amoxicillin, represented as a Molecule:
ChemicalConvert[ChemicalInstance[Molecule[{"S", "O", "O", "O", "O", "O", "N", "N", "N", "C", "C", "C", "C", "C", "C", "C", "C", "C",
"C", "C", "C", "C", "C", "C", "C", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H",
"H", "H", "H", "H", "H", "H", "H"}, {Bond[{15, ... irection" -> "Clockwise"], Association["StereoType" -> "Tetrahedral",
"ChiralCenter" -> 13, "Direction" -> "Counterclockwise"],
Association["StereoType" -> "Tetrahedral", "ChiralCenter" -> 19,
"Direction" -> "Counterclockwise"]}}], Quantity[0.6, "Moles"]], "Grams"]Calculate the amount in millimoles of 5 grams of "beefy meaty peptide", represented as a BioSequence:
ChemicalConvert[ChemicalInstance[BioSequence["Peptide", "KGDEESLA", {}], Quantity[5, "Grams"]], "Millimoles"]Generalizations & Extensions (2)
Compute the volume symbolically when the density is unknown:
ChemicalConvert[ChemicalInstance[ChemicalFormula[{"U" -> 1, "O" -> 2, {"H" -> 2, "O" -> 1} -> 5}, Association["NetCharge" -> 2]], <|"Mass" -> Quantity[2, "Milligrams"], "MassDensity" -> Quantity[, "Grams" / "Milliliters"]|>], "Liters"]Compute the amount of substance symbolically:
ChemicalConvert[ChemicalInstance[BioSequence["DNA", "ATAAACGTACGTTTTTAGGCT", {}], <|"Mass" -> Quantity[25, "Micrograms"], "MolarMass" -> Quantity[, "Grams" / "Moles"]|>], "Moles"]Applications (1)
How many moles of tricalcium diphosphate,
, can be produced from 5 grams of calcium hydroxide when it reacts with excess phosphoric acid to produce
and water? Start by balancing the chemical reaction:
rxn = ReactionBalance[ChemicalReaction[{Entity["Chemical", "CalciumHydroxide"], Entity["Chemical", "PhosphoricAcid"]} -> {Entity["Chemical", "CalciumPhosphate"], Entity["Chemical", "Water"]}]]Compute the stoichiometric ratio of
to :ratio = rxn["ProductCounts"][Entity["Chemical", "CalciumPhosphate"]] / rxn["ReactantCounts"][Entity["Chemical", "CalciumHydroxide"]]ChemicalConvert[ChemicalInstance[Entity["Chemical", "CalciumHydroxide"], Quantity[5, "Grams"]], "Moles"] * ratioPossible Issues (3)
If the molar mass of a chemical entity cannot be determined, ChemicalConvert remains unevaluated:
ChemicalConvert[ChemicalInstance[Entity["Chemical", "Polypropylene"], Quantity[2, "Moles"]], "Grams"]If properties of a chemical at a nonstandard temperature and pressure are unavailable, ChemicalConvert remains unevaluated:
ChemicalConvert[ChemicalInstance[Entity["Chemical", "1Butanol"], <|"Volume" -> Quantity[1, "Liters"], "Temperature" -> Quantity[400, "Kelvins"]|>], "Moles"]Multiple physical quantity keys can lead to unexpected results. Here, the "Mass" key has higher precedence than "Volume", so it is used for the conversion and the results replace the initial volume:
ChemicalConvert[ChemicalInstance[Entity["Chemical", "Methane"], <|"Phase" -> "Gas", "Volume" -> Quantity[5, "Liters"], "Mass" -> Quantity[5, "Grams"]|>], "Liters"]Related Guides
History
Text
Wolfram Research (2022), ChemicalConvert, Wolfram Language function, https://reference.wolfram.com/language/ref/ChemicalConvert.html.
CMS
Wolfram Language. 2022. "ChemicalConvert." Wolfram Language & System Documentation Center. Wolfram Research. https://reference.wolfram.com/language/ref/ChemicalConvert.html.
APA
Wolfram Language. (2022). ChemicalConvert. Wolfram Language & System Documentation Center. Retrieved from https://reference.wolfram.com/language/ref/ChemicalConvert.html
BibTeX
@misc{reference.wolfram_2026_chemicalconvert, author="Wolfram Research", title="{ChemicalConvert}", year="2022", howpublished="\url{https://reference.wolfram.com/language/ref/ChemicalConvert.html}", note=[Accessed: 18-June-2026]}
BibLaTeX
@online{reference.wolfram_2026_chemicalconvert, organization={Wolfram Research}, title={ChemicalConvert}, year={2022}, url={https://reference.wolfram.com/language/ref/ChemicalConvert.html}, note=[Accessed: 18-June-2026]}